Am J Hum Genet 2004; 74: 10231034. Int J Legal Med 1997; 110: 141149. Two additional markers, DYS38829, 30 and DYS46131 were typed separately. Parallel evolution of genes and languages in the Caucasus region. (This followed the publication of: Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. Russ J Genet 2004; 40: 326331. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. Y-chromosomal diversity in Lebanon is structured by recent historical events. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Google Scholar. Haplogroup P (P295) is also klnown as K2b2. This value of 12 is uncommon in other G categories other than G1. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a). Haplogroup G first locations (T. Kandell). The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. (2004) suggested the mutation took place only 9,500 years ago. It has been found in Mexican mestizos. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. [26][27] Among the Druze mostly residents of Israel 10% were found to be haplogroup G.[28], Around 10% of Jewish males are Haplogroup G.[citation needed], In Africa, haplogroup G is rarely found in sub-Saharan Africa or south of the horn of Africa among native populations. Am J Hum Genet 2007; 80: 759768. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Eur J Hum Genet 2009; 17: 820830. ASD0 is the average squared difference in the number of repeats between all current chromosomes of a sample and the founder haplotype, which is estimated as the median of current haplotypes. Haplogroup G (M201) is a human Y-chromosome haplogroup. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. [8][9], Furthermore, the majority of all the male skeletons from the European Neolithic period have so far yielded Y-DNA belonging to this haplogroup. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). Distribution. The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. Thus, these estimates should be viewed as the upper bounds of dispersal times. ), Haplogroup M, as of 2017, is also known as K2b1b. Chiaroni J, King RJ, Myres NM et al. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[17] and reached 21% in the town of Tempio in another study. G-M406* (G2a2b1*; previously G2a3a*) and its subclades seem most commonly found in Turkey and the coastal areas of the eastern Mediterranean where it can constitute up to 5% of all makes and 50% of haplogroup G samples. G2a2b2a is also found in India. Distribution. ISSN 1476-5438 (online) The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. ), Ancient G-M201s with sequencing[self-published source?] Genomics 1999; 57: 433437. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. The members of G-PF3359 are probably smaller in number than men included in G-P303, but only a small amount of testing has occurred for the relevant mutations. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. The haplogroup G mutation developed about 21,000 to 14,000 years ago. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. P287 was identified at the University of Arizona and became widely known in late 2007. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). The North Ossetians in the mid northern Caucasus area of Russia belong overwhelmingly to the G2a1 subclade based on available samples. The highest frequency values for P303 are detected in populations from Caucasus region, being especially high among South Caucasian Abkhazians (24%) and among Northwest (NW) Caucasian Adyghe and Cherkessians39.7% and 36.5%, respectively. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. Haplogroup G was the first branch of Haplogroup F outside of Africa. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Age All G-M377 men tested so far also have a rare null value for the DYS425 marker, (a missing "T" allele of the DYS371 palindromic STR), the result of a RecLOH event, a finding not yet seen among most other G haplotypes. However, no clinal patterns were detected in the spatial autocorrelation analysis of the five sub-haplogroup frequencies with distance, suggesting that the distributions are not clinal but rather indicative of isolation by distance and demographic complexities. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. Semino et al. [6], A more eastern origin has also been mentioned, believed by some to originate in an area close to the Himalayan foothills. Specifications for most markers have been previously reported,1, 17, 28 ISOGG 2011 (http://www.isogg.org/tree/). It is provided at the request of readers. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. The Caucasus are today mainly the countries of Georgia, Armenia, Azerbaijan and southwestern Russia. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. [2][37], Ancient DNA identified as G-PF3359 has been found at archaeological sites in: Hungary (the subclade G-F872*), dated at 7,500 years before present (BP); Hungary (subclade G-F1193*) 7,150 BP, and; Spain (G-PF3359*) 4,700 BP.[2]. Haplogroup G is observed in this survey as G1-M285 and G2a-P15. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). Another notable feature is its uneven distribution. Pichler I, Fuchsberger C, Platzer C et al. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Men who belong to this group but are negative for all its subclades represent a small number today. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. Categories have alternating letters and numbers. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. If a sample meets the criteria indicated for these three markers, it is likely the sample is G2a2b1. There were only a few G categories until 2008 when major revisions to categories were made. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Conversely, hg G is present in Northeast Caucasus only at an average frequency of 5% (range 019%). G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. contracts here. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the populations of Europe and the Caucasus. Pericic M, Lauc LB, Klaric IM, Janicijevic B, Rudan P : Review of croatian genetic heritage as revealed by mitochondrial DNA and Y chromosomal lineages. Rosser ZH, Zerjal T, Hurles ME et al. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Haplogroup LT (L298/P326) is also known as Haplogroup K1. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. Origin. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). Yunusbayev B, Metspalu M, Jrve M et al. Iceman tzi, known to have been a haplogr. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. Y chromosomal heritage of Croatian population and its island isolates. Ancient DNA suggests the leading role played by men in the Neolithic dissemination. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Network of 248 samples P303 derived from Supplementary Table S3. Artefactual values below 0% values were not depicted. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. Haplogroup G1 is a primary subclade of haplogroup G . But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. Hammer MF, Behar DM, Karafet TM et al. Even more G SNPs were identified in 2009 to 2012 leading to more changes. They are found only in tiny numbers elsewhere. AAL thanks the Sorenson Molecular Genealogy Foundation. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. Kaniewski D, Van Campo E, Van Lerberghe K et al. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. The Turkish G-M377 is somewhat closer, but not identical. Am J Hum Genet 2004; 74: 5061. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Mol Biol Evol 2011; 28: 29052920. We genotyped binary markers following PCR amplification, by either Denaturing High Performance Liquid Chromatography, RFLP analysis, Taqman assay (Applied Biosystems, Foster City, CA, USA) or direct Sanger sequencing methodology. Chromosome Y microsatellites: population genetic and evolutionary aspects. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. volume20,pages 12751282 (2012)Cite this article. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Sengupta S, Zhivotovsky LA, King R et al. In order to determine if one of these alternative SNPs represents a subclade of M201, the alternative SNPs must be tested in G persons who are negative for the known subclades of G. There are only a tiny number of persons in such a category, and only a tiny number of persons have been tested for G equivalent SNPs other than M201. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. The Sea Peoples, from cuneiform tablets to carbon dating. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). . PLoS One 2011; 6: e20232. Internet Explorer). Ancient DNA from European early neolithic farmers reveals their near eastern affinities. The identities of the specific 19 loci that define the STR haplotypes are reported in Supplementary Table S3 and Figure 4 legend. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. SR thanks the Estonian Science Foundation for grant 7445 and M Metspalu for grant 8973. (a) Principal component analysis by population. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. Cinnioglu C, King R, Kivisild T et al. It is not found among Native Americans except where intermarriage with non-native persons has occurred. Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Am J Hum Genet 2008; 82: 873882. In other words, these mutations are so unique that they could only come from other cells with the same mutations. (2000) suggested 17,000 years ago. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. Keller A, Graefen A, Ball M et al. Cavalli-Sforza L, Menozzi P, Piazza A : The History and Geography of Human Genes. the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Nei M : Molecular Evolutionary Genetics. Elizabeth T Wood, Daryn A Stover, Christopher Ehret, L177, later discarded in favour of PF3359 and equivalent SNPs, was first identified at. Thank you for visiting nature.com. The general frequency pattern of hg G overall (Figure 2a) shows that the spread of hg G extends over an area from southern Europe to the Near/Middle East and the Caucasus, but then decreases rapidly toward southern and Central Asia. Google Scholar. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Evaluation of Y-chromosomal STRs: a multicenter study. L2b1a. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. Am J Hum Genet 2008; 82: 236250. No clinal patterns were detected suggesting that the distributions are rather indicative of isolation by distance and demographic complexities. Please help update this article to reflect recent events or newly available information. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. Eur J Hum Genet 20, 12751282 (2012). Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. Although the present-day frequency of G1 is low across its spread zone, the expansion time estimate (Supplementary Table S4) of 192716158 years attests to considerable antiquity. The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. Members of this group have been found in Europe and the Middle East.[3]. In the case of the general frequency pattern of hg G, panel (a) was obtained by applying the frequencies from Supplementary Table S1 together with data taken from the literature, concerning 569 individuals representing 7 populations comprising Algerians,47 Oromo and Amhara Ethiopians,48 and Berbers, Arabs and Saharawis from Morocco.49 Dots on the map (a) indicate the approximate locations of the sampled populations. Herein . The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics Two sources of the Russian patrilineal heritage in their Eurasian context. The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. PAU thanks Professor Carlos D Bustamante. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Marie Lacan, Christine Keyser, Franois-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubzy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. In the Americas, the percentage of haplogroup G corresponds to the numbers of persons from Old World countries who emigrated. Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). Goncalves R, Freitas A, Branco M et al. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. The L141 mutation is found on the Y chromosome at 2948607. Nature 2010; 466: 238242. Vernesi C, Caramelli D, Dupanloup I et al. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west.

Maxim Defense Pdx Full Auto, What Does Kiki Mean In Hawaiian, Amentum Employee Benefits, Albion Sword Scabbards, Tour Pros Using Edel Putters, Articles H